Randomizowana próba chemioradioterapii i chemioterapii po resekcji raka trzustki ad 5

Szacunki przeżycia dwuletniego i pięcioletniego wynosiły odpowiednio 40 procent i 21 procent wśród pacjentów otrzymujących chemioterapię oraz odpowiednio 30 procent i 8 procent wśród pacjentów, którzy nie otrzymali chemioterapii (Figura 2B). Wykres Forrest (ryc. 4) potwierdził istotną korzyść w zakresie przeżycia dla chemioterapii niezależnie od tego, czy pacjenci byli losowo przydzielani do chemioterapii. Dodatkowe analizy przeżycia
Mediana przeżycia wyniosła 16,9 miesiąca (przedział ufności 95 procent, 12,3 do 24,8) wśród 69 pacjentów losowo przydzielonych do obserwacji, 13,9 miesięcy (przedział ufno...

Hamowanie funkcji ludzkich leukocytów polimorfojądrowych za pomocą 2-cykloheksen-1-onu. Rola glutationu w aktywacji komórek.

2-cykloheksen-1-on i maleinian dietylu swoiście obniżają poziomy zredukowanego glutationu (GSH) w ludzkich leukocytach wielojądrzastych (PMN) poprzez bezpośrednią koniugację i przez interakcję z układem s-transferazy glutationowej. Korzystając z tych dwóch nietoksycznych odczynników, zbadaliśmy wpływ obniżonych poziomów GSH na pięć parametrów aktywacji PMN: generowanie nadtlenku, uwalnianie enzymów lizosomu lizozymu i beta-glukuronidazy oraz wzrost napływu Na + i Ca2 +. Gdy PMN poddawany wstępnej obróbce za pomocą 2-cykloheksen-1-onu lub maleinianu dietylu inkubowano z formylo-metionylo-leucylo-fenyloalaniną (FMLP...

Niezadowolenie z praktyki lekarskiej

Artykuł Zugera (wydanie stycznia) o niezadowoleniu lekarzy jest fascynujący, ale nie wspomina o tym, że opieka zdrowotna jest coraz bardziej zdominowana przez duże organizacje, których liderzy mogą czasami być niekompetentni, zainteresowani sobą, a nawet skorumpowani. Ponieważ siła skupia się w większych organizacjach, wzrasta także zdolność ich przywódców do czynienia dobrych lub chorych.2 Zuger cytuje Ludmerera, ale nie jego obawy dotyczące szkoły medycznej i urzędników szpitala [którzy] zbliżyli się do akademii medycznych tak, jakby te instytucje były wytwarzanie samochodów lub płatków śniadaniowych. 3

Wyniki neurorozwojowe we wczesnym CPAP i próbie pulsoksymetrii AD 8

Reakcje (całkowita objętość 25 .l) zawierały 2,5 .l buforu 10X PCR Gold, 2,5 mM chlorku magnezu, 0,4 mM trifosforanów deoksynukleozydu (Roche Diagnostics), 0,8 mM każdego z dwóch starterów i 0,5 jednostki polimerazy DNA AmpliTaq Gold. (Applied Biosystems). Próbki od pacjentów 1, 2, 3 i 4 testowano za pomocą zestawu primerów dla genu H5 (starter przedni H5-1: GCCATTCCACAACATACACCC; primer odwrotny H5-2: TAAATTCTCTATCCTCCTTTCCAA) o oczekiwanym rozmiarze produktu 358 pz, 2 i zestaw starterów dla genu N1 (starter przedni N1-1: TTGCTTGGTCAGCAAGTGCA, starter odwrotny N1-2: TCTGTCCATCCATTAGGATCC) o spodziewanym rozmiarze produktu ...

Najnowsze zdjęcia w galerii fuhmalepszy:

331#nerwiak mortona , #przepiśnik allegro , #nefropatia toczniowa , #trojglicerydy norma , #czerniak guzkowaty , #citrosept działanie , #skrzydlik w oku , #liczne pasma śluzu w moczu przyczyny , #polipowatość rodzinna , #zespół sapho ,