Dobowe zmiany w aktywności współczulnej. Stosunek do przyjmowania pokarmu i insuliny wstrzykniętej do jądra ventromedialnego lub nadskrzyżowanego.

Niniejsze badanie zostało zaprojektowane w celu sprawdzenia, czy istnieją dzienne zmiany szybkości odpalania nerwów współczulnych w brązowej tkance tłuszczowej i czy te dobowe rytmy wpływały na odpowiedź na insulinę wstrzykniętą do jądra nadskrzyżkowego lub brzuszno-przyśrodkowego jądra podwzgórzowego (VMH). Pobór pokarmu był najwyższy na początku ciemnego okresu (1800-2200 godzin), a najniższy w godzinach dziennych (0600-1000 i 1200-1600 godzin). Podstawowy współczynnik wypal...

Eksperymentalna otyłość u ludzi: komórkowy charakter tkanki tłuszczowej

Badania nad komórkowością tkanki tłuszczowej przeprowadzono w grupie nieotwartych dorosłych ochotników płci męskiej, którzy uzyskali 15-25% masy ciała w wyniku przedłużonego wysokiego spożycia kalorii. Rozmiar komórek tłuszczowych (zawartość lipidów w komórce) określono w tkance uzyskanej z trzech miejsc podskórnych (pośladków, przedniej ściany brzusznej i triceps) oraz całkowitej liczby komórek tłuszczowych oszacowanej na podstawie pomiaru całkowitej tkanki tłuszczowej. Pi...

Ptasia grypa A (H5N1) u 10 pacjentów w Wietnamie cd

Reakcje (całkowita objętość 25 .l) zawierały 2,5 .l buforu 10X PCR Gold, 2,5 mM chlorku magnezu, 0,4 mM trifosforanów deoksynukleozydu (Roche Diagnostics), 0,8 mM każdego z dwóch starterów i 0,5 jednostki polimerazy DNA AmpliTaq Gold. (Applied Biosystems). Próbki od pacjentów 1, 2, 3 i 4 testowano za pomocą zestawu primerów dla genu H5 (starter przedni H5-1: GCCATTCCACAACATACACCC; primer odwrotny H5-2: TAAATTCTCTATCCTCCTTTCCAA) o oczekiwanym rozmiarze produktu 358 pz, 2 i zestaw starteró...

Guzy te moga dac obraz przewleklego samoistnego nadcisnienia o przebiegu lagodnym lub ciezkim

Uczestnicy zwrócili pocztą kwestionariusz w 1986 r. Dotyczący diety, historii medycznej i leków. Spośród 49 932 mężczyzn, którzy dostarczyli kompletne informacje dietetyczne, 2782 (5,6 procent) zgłosiło daninę w historii w kwestionariuszu podstawowym. Ci mężczyźni zostali wykluczeni z naszej analizy, pozostawiając 47 150 uczestników. Ocena diety
Aby ocenić spożycie, wykorzystaliśmy półilościowy kwestionariusz dotyczący częstotliwości żywności, w którym zapytano o ś...

Najnowsze zdjęcia w galerii fuhmalepszy:

331#nerwiak mortona , #przepiśnik allegro , #nefropatia toczniowa , #trojglicerydy norma , #czerniak guzkowaty , #citrosept działanie , #skrzydlik w oku , #liczne pasma śluzu w moczu przyczyny , #polipowatość rodzinna , #zespół sapho ,