Rola zwiększonego wolnego wapna cytozolowego w patogenezie uszkodzenia proksymalnego komórek kanalików i ich ochrony przez glicynę lub kwasicę.

Aby ocenić rolę zwiększonego wolnego wapnia cytozolowego (Caf) w patogenezie ostrego uszkodzenia komórek proksymalnego kanalików i ochrony zapewnianej przez ekspozycję na obniżone średnie pH lub traktowanie glicyną, kanaliki obciążone fura-2 badano w zawiesinie i pojedynczo w system superfuzji. Jonofor Ca2 +, jonomycyna, zwiększał Caf do poziomu mikromolowego i szybko powodował śmiertelne uszkodzenie komórek, jak wykazano przez utratę dehydr...

Eozynopenia ostrej infekcji: PRODUKCJA EOSINOPENII PRZEZ CHEMOTAKTYCZNE CZYNNIKI INFLAMMACJI OSTREJ

Jeden charakterystyczny aspekt odpowiedzi na ostre zapalenie obejmuje szybkie i ciągłe zmniejszanie liczby krążących eozynofili, jednak mechanizmy tej eozynopenii są niezdefiniowane. Jedną z możliwości jest to, że nagła eozynopenia może być wynikiem uwolnienia niewielkich ilości chemotaktycznych czynników ostrego zapalenia do krążenia. Badania te zaprojektowano w celu zbadania liczby krążących eozynofili po dożylnym wstrzyknięciu surowi...

Początkowe leczenie agresywnego chłoniaka za pomocą chemioterapii wysokodawkowej i wspomagania autologicznych komórek macierzystych cd

Każdy kurs był wspierany 5 .g czynnika stymulującego wzrost kolonii granulocytów i makrofagów (Schering-Plough) na kilogram masy ciała na dzień dożylnie lub podskórnie, począwszy od dnia 5 każdego kursu. Dokanałowe wstrzyknięcie metotreksatu (15 mg) i metyloprednizolonu (20 mg) podawano rutynowo drugiego dnia każdego z dwóch cykli CEEP. Dwie lub trzy leukapfezy wykonano po pierwszym lub drugim przebiegu, lub w obu kursach, w celu uzyskania co ...

Budownictwo i architektura : Alexandria / Anonymous Studio

Reakcje (całkowita objętość 25 .l) zawierały 2,5 .l buforu 10X PCR Gold, 2,5 mM chlorku magnezu, 0,4 mM trifosforanów deoksynukleozydu (Roche Diagnostics), 0,8 mM każdego z dwóch starterów i 0,5 jednostki polimerazy DNA AmpliTaq Gold. (Applied Biosystems). Próbki od pacjentów 1, 2, 3 i 4 testowano za pomocą zestawu primerów dla genu H5 (starter przedni H5-1: GCCATTCCACAACATACACCC; primer odwrotny H5-2: TAAATTCTCTATCCTCCTTTCCAA) o oczekiwanym ro...

Najnowsze zdjęcia w galerii fuhmalepszy:

331#nefropatia toczniowa , #trojglicerydy norma , #czerniak guzkowaty , #citrosept działanie , #skrzydlik w oku , #liczne pasma śluzu w moczu przyczyny , #polipowatość rodzinna , #zespół sapho , #pasma śluzu w moczu , #talkowanie płuc ,